need help plzzzzzzzz In this assessment, you will categorize a group of animals by two forms of classification: phylogeny (cladistics) and Linnaean taxonomy. For phylogeny, you will create a cladogram for your groups of animals. For Linnaean classification, you will create a taxonomy chart or concept map that categorizes your species by taxa. Select from the two groups of animals listed below for your project.

Bird Group: Blue Jay, robin, cardinal, finch, and pelican
Insect Group: African honeybee, grasshopper, black widow spider, mosquito, and yellow jacket

Elements. Knowledge of basic science includes the distinction between atoms and molecules, and elements, mixtures and compounds. ...

Molecules. The size of molecules varies enormously depending on the type of molecule.

Organelles.

Cells.

Tissues.

Organs.

Organ Systems.

Organism.

Answer:

a

Explanation:

hope it helps

Answer: almost imposiable

Explanation: If you do happen to get picked up a tornado the longest time you will stay in it is approximately 5 minutes before it throws you out of it. If you did so happen to be swept in a tornado near a island it is possiable, but tornados over water die very very fast so this is very unlikley.

Hope this helps

Answer:

Nope.

Explanation:

Now I don't know anything about much about tornado's. But I'm pretty sure it won't pick up that person and send it to another island. I don't think the tornado have enough force to throw the person to another island. It will, however, send that person on another area maybe close to the tornado area. But yet again I don't the tornado have the abilty to do that.

Answer:

an increase in skin cancer can be traced to a decrease in atmospheric ozone.

Happy to help

pls mark as Brainliest

Answer: Ozone

Explanation: There is a increase in chance of cancer now a days as compared to earlier time because of ozone depletion.

Due to various types of human activities there are many holes in the ozone due to which harmful ultraviolet rays is entering on earth and there is an increase in the chances o skin cancer.

So, the correct answer is ozone

Answer: A. with sperm

Explanation:

Structure A in Figure 10-4 is the centrioles.  role does structure A play in mitosis  is: (c) connect to spindle fibers

Centrioles are paired organelles that are found in the cytoplasm of eukaryotic cells. They are composed of microtubules, which are long, thin filaments that form the structural framework of the cell. During interphase, the centrioles are located near the nucleus and are surrounded by a cloud of protein called the centrosome.

As the cell progresses into mitosis, the centrioles replicate and move to opposite poles of the cell. This process is called centrosome separation. The centrosomes act as organizing centers for the spindle fibers, which are microtubules that extend from the centrosomes and attach to the chromosomes. The spindle fibers play a crucial role in separating the chromosomes during mitosis.

Answer:

Can you give me more details about this question?

Answer:

wdym

Explanation:

The statement (A) is correct. A disagreement between people with opposing viewpoints.

A conflict is a struggle and a clash of interest, opinion, or even principles. Conflict will always be found in society; as the basis of conflict may vary to be personal, racial, class, caste, political and international.

Moreover, conflict is serious disagreement and argument about something important. If two people or groups are in conflict, they have had a serious disagreement or argument and have not yet reached agreement. Try to keep any conflict between you and your ex-partner to a minimum.

Therefore, the opposing force created, the conflict within the story generally comes in four basic types: Conflict with the self, Conflict with others, Conflict with the environment and Conflict with the supernatural.

Learn more about conflicts:

https://brainly.com/question/12832202

#SPJ2

Answer:

a.The template DNA strand, from which the mRNA is synthesized, is 5’ CAAACTACCCTGGGTTGCCAT 3’

(RNA synthesis proceeds in a 5’ à 3’ direction, so the template strand and the mRNA will be complementary to each other)\

b.The coding DNA strand, which is complementary to the template strand, is 5’ ATGGCAACCCAGGGTAGTTTG 3’

c. The sequence of the mRNA is 5’ AUGGCAACCCAGGGUAGUUUG 3’

(the sequence of the mRNA is complementary to the template strand and identical to the coding strand with U substituted for T)

d.The third codon is 5’ ACC 3’.  Therefore, the corresponding anti-codon is 5’ GGU 3’

Answer:

A. carry the sound energy to the brain. B. collect the sound waves. C. amplify the received sound. D. vibrate with the frequency of the received sound.

These are the choices right? Well, I think that its D. vibrate with the frequency of the received sound. I hope its correct bc im on the same question.. good luck:) {MARK BRAINLIEST!!!}

The two immediate functions of the eardrum are auditory and protective.

The eardrum is the membrane of the middle year which vibrates in response to sound waves; also the tympanic membrane.

The earwax is the part of the ear that protects the eardrums from dirt and infections. These are produced by glands in the skin linings of the ear canal responsible for protecting the ear. The ear is divided into three sections: Outer, middle, and inner ear.

Earwax is found in the outer ear section lining the ear canal protecting the passage to the eardrum.

Earwax when removed in excessive amounts may cause the ears to develop certain infections and might cause the infections of the other sections of the ears as well.

Thus, this could be the answer.

To learn more about eardrum  click here:

https://brainly.com/question/13740969

#SPJ2

Answer is B bacillus

The bacteria shown in the image are bacillus bacteria. Therefore, option A is correct.

Bacillus bacteria are a group of rod-shaped, gram-positive bacteria that belong to the genus Bacillus. They are characterized by their ability to form endospores, which are dormant structures that allow them to survive in harsh conditions. Bacillus bacteria are widely distributed in nature and can be found in soil, water, and various organic materials.

Some notable species of Bacillus include Bacillus subtilis, Bacillus cereus, and Bacillus anthracis. Therefore, option A is correct.

Learn more about Bacillus bacteria, here:

https://brainly.com/question/11201874

#SPJ4

Answer:

C. It is caused by a virus, not a bacterium

Explanation:

The answer is C influenza is caused by viruses not a bacterium

viruses invade your cells and the antibiotics can’t get to your cells through the blood they can only kill bacteria which harbours inside the blood

1) Variation: there needs to be a difference in the individuals within a population

2) Inheritance: These variable traits must be able to be passed down genetically

3) Growth rate: There needs to be a growth rate that requires a struggle for resources

4) Survival rate: There needs to be a difference in survival rate for the different variation types... certain variations will live

The four principles of natural selection are variation, inheritance, high rate of population growth, and differential survival and reproduction. This means members of a species are variable, part of this variation is inheritable, populations produce more offspring than can survive, and those with better survival traits are more likely to pass them on.

The four principles of natural selection are: variation, inheritance, high rate of population growth, and differential survival and reproduction.

The principal of variation means individuals within species are variable. Inheritance means that some of these variations are passed on to offspring. High rate of population growth means that populations produce more offspring than can survive, leading to competition. Lastly, differential survival and reproduction states that individuals with advantageous traits are more likely survive and reproduce than those without these traits.

Combined, these principles drive the process of natural selection, causing species to adapt to their environments over time. In any given environment, the individuals with traits best suited to that environment will have the greatest chances of surviving and passing those traits on to the next generation.

https://brainly.com/question/32227158

#SPJ6

Answer:

Frost wedging occurs as the result of expansion of water when it is converted to ice. Cracks filled with water are forced further apart when it freezes.

Answer: The correct option is water freezes inside a rock, causing it to break

Explanation:

Answer:B, tectonic plates

Explanation:

In order: osmosis, higher, lower

Osmosis higher lower

The correct answer is D

The accurate statement about an extrusive igneous rock is that it formed from cooling lava, which cools quickly at the Earth's surface, leading to a finer-grained texture.

Based on the information that a geologist concludes a rock sample is an extrusive igneous rock, the accurate statement about the rock is A. The rock formed from cooling lava. Extrusive igneous rocks such as basalt are formed above the surface when molten rock, known as lava, extrudes onto the Earth's surface and cools quickly. This rapid cooling does not allow large crystals to form, leading to a finer-grained texture, and in some cases, such as with obsidian, a glassy texture due to the extremely rapid cooling.

Option B is incorrect because rocks that come from plutons are intrusive, rather than extrusive, and they cool slowly within the Earth's crust. Option C is incorrect as extrusive igneous rocks do not cool slowly over millions of years. Option D is also incorrect because extrusive igneous rocks form at the Earth's surface, not within the Earth's crust.

Answer:

The lytic cycle involves the reproduction of viruses using a host cell to manufacture more viruses; the viruses then burst out of the cell. The lysogenic cycle involves the incorporation of the viral genome into the host cell genome, infecting it from within.

Answer:

Chemosynthesis

Explanation:

Its right trust me

the correct answer is chemosynthesis <3

It's B

That's the only one up there with both.

Eukaryotic cells contain a nucleus and membrane-bound organelles.  

Option B

Explanation:  

Eukaryotic cells consists of membrane bound organelle, when we talk about organelle it is a structure within a living cell which is specialized. The organelles consist of nucleus, ''endoplasmic reticulum'', ''Golgi apparatus'', ''vacuoles'', ''lysosomes'', ''Mitochondria''. These organelles is surrounded by a phospholipid bilayer. With this foundation, the organelles have cell to control what enters and leaves it. These cells are controlled by selective permeability which has the enter and exit in control of any object.

I think its 3)in orbit around the sun

i hope i helped even just a little :)

3) in orbit around the sun.

Learn more:

brainly.com/question/17717852

Answer:

C

Explanation:

Producers require solar energy to start photosynthesis to create the glucose they need, so lower solar energy means less photosynthesis.

Answer: C. Producer populations will decrease, causing a decrease in consumer populations.

Explanation:

According to the situation, the volcanic ash will mask the light energy from sun. The sunlight is the main requirement for the producers to synthesize their own food by the process of photosynthesis. The population of plants and other autotrophs will be affected by this. The other organisms in the ecosystem will be affected as decline in the population of producers will result in decline in the population of consumers due to lack of food.  

Answer: phototropism

Explanation: phototropism is a plant's response to light.

Plants growing toward sunlight is known as tropism, a response to stimuli.

Tropism is the action by which a plant grows toward sunlight. This growth movement is a response to stimuli where the plant or a part of it grows in the direction from which the stimulus originates.

Explanation:

Geese fly together in a v formation.

Geese fly together because when the first goose flaps it's wings it creates an upward force which make it easier for the second goose to fly.

In this way the force increases and the effort the last goose has to spend to fly decreases a lot.

Hope it helps you.

please mark as brainliest.

Answer:

B. to save energy

Explanation:

ody ssey Unit 3, Assignment 2. Animal behavior and Interdependencies, page 4, under Group Animal Behavior, paragraph 2, from " The lead goose....V formation.....making their flight easier."  

nowhere in my ody ssey unit materials did it mention otherwise or geese again.  

Answer:

The correct answer is reproductive part.

Explanation:

The mushroom belongs to the family of fungus. It is composed of two parts one underground part called as mycellium and the other part which can be seen above the ground. This part is the reproductive part of mushroom which is often edible. The other parts of the mushroom includes stem, hypae, volva, spores, gill, ring cap. There are variety of mushrooms available but all the forms are not eatable some of them are poisonous to human health.

Answer:

A

Explanation:

Answer: 1. Nature conservancy

Explanation:

Nature conservancy is the process or initiative taken by the human society to conserve the regions of forests and the associated wildlife, fossil fuels, water sources and others. This practice will ensure that the valuable resources will remain available for the present as well as for the future generation of human beings.

On the basis of the above description, nature conservancy is the activity which will help the environmental activists to save the forests.

A single mutation can have a large effect, but in many cases, evolutionary change is based on the accumulation of many mutations. I hope this help you

Answer:

i sai sai

Explanation:

sia sia sai In a running relay, each runner ran an equal part of the total distance.  Joseph and 3 othe

Introduced species can harm our planet because in some regions of the world we are not prepared for their type of species, which can all in all cause damage.

Answer: alteration of the ecosystem

Explanation:when a new specie is introduced into the ecosystem it may have profound affects in the ecosystem and may also be called an invasive specie.

The affects that it may have on the ecosystem include

1.outcompeting the native specie and sometimes even leading to their extinction because the new specie may be modified in such a way as to have better chances of survival in the ecosystem because of their evolved genetics e.g : the new specie may encounter a native and non evolved specie of the ecosystem and compete with it for survival leading to reduction and even complete eradication of the native specie

Answer:B

Explanation:

Answer:A nucleotide

Explanation:

Apex:)

Answer:

The volcanic activity led to the release of large amounts of carbon dioxide at the end of the Devonian period

Explanation:

Devonian period is refereed as the Age of fish. It is also called an era of mass Extinction. During the end of Devonian period most of the terrestrial animals were extinct from Earth. Another big feature of Devonian period was massive volcanic activity which contributed to the release of carbon dioxide in the environment.