What is a feature of bones that are still increasing in length?

Answers

Answer 1
The appropriate response is ligament in epiphyseal plate. The epiphysis is the adjusted end of a long bone, at its joint with contiguous bone(s). Between the epiphysis and diaphysis lies the metaphysis, including the epiphyseal plate. It is a hyaline ligament plate in the metaphysis at each finish of a long bone.
Answer 2

ligament in epiphyseal plate


Related Questions

Which term means increasing the angle between two bones of the straightening of a limb?

Answers

extension- increasing the angle between two boned of the straightening of a limb

Which abiotic factor is essential to all aquatic ecosystems except ocean hydrothermal vents and why?

Answers

The abiotic factor that is essential for all aquatic ecosystem with the exception of hydro thermal vent is SUNLIGHT, THIS IS BECAUSE IT PROVIDES A SOURCE OF ENERGY. 
Sunlight is very essential for aquatic ecosystems because it is the principal source of energy from which aquatic plants trap energy to make their food and provided mean of sustenance for themselves and other organisms in the water.
Final answer:

Sunlight is the essential abiotic factor in aquatic ecosystems as it facilitates photosynthesis, except in ocean hydrothermal vents where organisms rely on chemosynthesis.

Explanation:

The abiotic factor essential to all aquatic ecosystems, except ocean hydrothermal vents, is sunlight. This factor is crucial because it influences the process of photosynthesis, which is central to the communities of organisms found in both freshwater and marine ecosystems. Sunlight affects the productivity of aquatic biomes as it controls photosynthesis, which is essential for the sustenance of primary producers in these ecosystems. In most aquatic environments, light penetration dictates the distribution of organisms, as some zones receive ample sunlight (photic zones) while others receive none (aphotic zones). However, hydrothermal vent communities rely on chemosynthesis — a process by which certain microbes convert chemicals from the vents into energy — making sunlight unnecessary for their energy production.

Learn more about Sunlight in Aquatic Ecosystems here:

https://brainly.com/question/985835

#SPJ3

Where is the youngest crust material found on Earth?

Answers

underwater mountain chains called also known as mid-ocean ridges

Answer:

At divergent boundaries in the middle of the ocean (mid-ocean ridges)

=)

Insulin is a(n) ________ that lowers blood sugar by allowing the body's cells to absorb glucose from the blood.

Answers

Is a hormone produced by the pancreas

The fitt principle is applied to physical activity and exercise. what does fitt represent

Answers

Frequency, Intensity, Time, and Type.
Final answer:

The FITT principle represents Frequency, Intensity, Time, and Type, which are guidelines for creating an effective physical exercise program to enhance physical fitness and good health.

Explanation:

The FITT principle is a set of guidelines that can help you structure a physical exercise program effectively. FITT stands for Frequency, Intensity, Time, and Type:

Frequency refers to how often you engage in physical activity or exercise.Intensity indicates how hard you exercise during a workout session.Time refers to the duration of each exercise session.Type means the kind of exercise you do to improve or maintain physical fitness and overall good health.

Employing the FITT principle helps ensure that the workouts you perform are balanced and cover all aspects necessary for a comprehensive fitness program. This can include a combination of cardiovascular exercises, strength training, and flexibility workouts.

What is the basic structural unit of both dna and rna?

Answers

The Nucleotide. DNA and RNA are both nucleus acids. Nucleic acids' monomer is called a nucleotide.

A wild fastball pitch that hits the nose of the batter can drive bone fragments through the ____________ of the ethmoid bone and into the meninges or tissue of the brain.

Answers

A wild fastball pitch that hits the nose of the batter can drive bone fragments through the cribriform plate of the ethmoid bone and into the meninges or tissue of the brain.

When a wild fastball pitch hits a batter's nose forcefully, it can break the ethmoid bone's cribriform plate, which has small openings for nerves. Bone fragments can then enter the cranial cavity and potentially damage brain tissue or the meninges, the protective membranes covering the brain.

Sonal had a stroke. doctors told her she sustained substantial damage to the occipital lobes. what type of deficiencies will sonal likely experience as a result of this brain damage?

Answers

Because the occipital lobes are responsible for visual perception, damge to them may cause the person the inability to reconize colors,  some people may experience servere vision problems or blindless,

The antibody molecule is held together by ________ bonds.

Answers

It is the disulphide bond. 

How does erosion by groundwater create a landform

Answers

erosion by ground water creates land forms be sweeping away sediment and other things like rocks and dirt. over time the water creates a channel so there is one place for it to flow. overtime the channel  gets deeper like a ditch. and eventually a river or stream.

The nurse provides discharge teaching to a client related to management of the client's new colostomy. the client states, "i hope i can handle all of this at home; it's a lot to remember." what is the nurse's best response?

Answers

There's a possibility that the patient with colostomy would have not enough knowledge in treating himself at home. In order to help the patient, the nurse should evaluate first the patient's cognitive, physical, and emotional capabilities in order to know the patient's willingness to be responsible for caring his colostomy and also for his mastery in doing the tasks assigned to him. The nurse should also provide references for additional information and support to the patient in his independence in  taking care of himself. The nurse should give picture, video, internet, written resources for that. 

What to do during study hall when you have no homework?

Answers

You can do your homework, search for a project you may have, read etc
You should try doing something that will affect your grade by going up
1.study
2.finsish any missing asinements
3.study for a test
4.finish anything that's due
I hope this helps.. :)

Identify the medical term referring to a (head) cold:

Answers

The medical term referring to a head cold is coryza. The coryza occurs when an individual’s mucous membranes in their nasal cavity has a presence of inflammation in which will likely result into having a hay fever or causing a person to have a cold.

Final answer:

The medical term referring to a (head) cold is rhinorrhea, which is the excessive production of mucus in response to a viral infection. It is a common symptom of a cold and is often accompanied by sneezing, congestion, sore throat, and coughing.

Explanation:

The medical term referring to a (head) cold is rhinorrhea. Rhinorrhea is the medical term for a runny nose, which is a common symptom of a cold. It occurs when the nasal tissues produce excessive mucus in response to a viral infection. Other symptoms of a cold may include sneezing, congestion, sore throat, and coughing.

Learn more about Rhinorrhea here:

https://brainly.com/question/34319474

#SPJ6

similarities between outer planets and inner planets

Answers

the outer planets are big and cold but the inner planets have more warmth and in earths case LIFE

What are two systems are primarily responsible for maintaining homeostasis during exercise?

Answers

The two system that are primarily responsible for  maintaining homeostasis during exercise are RESPIRATORY AND CIRCULATORY SYSTEMS.
During exercise, the respiratory and the circulatory systems work together to ensure that partial pressure of oxygen in the arteries is maintained, efficient elimination of carbon dioxide and buffering of metabolic acids produce during exercise.

What has uekaryotik cells liver, virus, oak, lactobacillus?

Answers

Eukaryotic cells have chromosomes, a membrane-bound nucleus, and membrane-bound organelles, practically any living thing. Eukaryotic cells are also considered animal cells. 

It could be both liver and oak
It could also just be liver if it specifies eukaryotic animal cells. 

A cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction. hints a cross between a tetraploid and a diploid member of the same species will produce offspring that can undergo sexual reproduction.
a. True
b. False

Answers

False

In order to happen sexual reproduction, the cells that origin gametes must have an even number of chromosomes. By crossing a tetraploid (4n) with a diploid (2n), the offspring would have a total number of 3 copies of each chromosome (2 from the tetraploid parent and 1 from the diploid parent), which when undergoing sexual reproduction would not allow meiosis to happen because the chromosomes could not be evenly divided to gamete cells.

The processes of endocytosis and exocytosis both require?

Answers

require cells to expend energy

Answer: Uses vesicles

How can blimps be of use in scientific studies of the air?

Answers

Blimps are efficient vehicles for holding a wide range of scientific instrumentation at various altitudes that scientists can choose. They could measure barometric pressures, temperature, concentrations of specific chemicals using special equipment, humidity using hygrometers, et cetera. Blimps also could be used to track air currents since blimps drift as they are pushed by winds.

Your patient tells you he is a jehovah's witness. what should you do to show your support for his spiritual beliefs?

Answers

Get to know your patient, learn more about it. that will show that you support his/her believes.

Final answer:

To show support for a patient who is a Jehova's Witness, it is important to understand and respect their spiritual beliefs. Ask about their specific beliefs, align medical treatments with those beliefs, and provide relevant resources and connections.

Explanation:

If your patient identifies as a Jehova's Witness, it is important to respect and support their spiritual beliefs in your role as a healthcare provider. Here are some steps you can take to show your support:

Ask your patient about their specific beliefs and practices as a Jehova's Witness. This will help you understand their unique needs and preferences.Ensure that any medical treatments or procedures align with their religious beliefs. For example, Jehova's Witnesses may refuse blood transfusions due to religious reasons, so it is important to explore alternative treatment options.Provide resources and connect your patient with a medical team that has experience working with Jehova's Witnesses. This can help ensure that their spiritual beliefs are respected throughout their healthcare journey.

A mother brings her 9-month-old infant to the clinic. the nurse is familiar with the mother's culture and knows that belly binding to prevent extrusion of the umbilicus is a common practice. the nurse accepts the mother's cultural beliefs but is concerned for the infant's safety. what variation of belly binding does the nurse discourage?

Answers

The variation of belly binding that the nurse discourage is the coin in the umbilicus. It is because the coin used can be dislodged in which maybe an issue in terms of the safety of the infant as this could result of having the infant to put the coin in his or her mouth.

Tortoises with long necks were found to be abundant in regions that had vegetation on a higher level. A few years later, drought hit the region and the vegetation dried up. Over time, grasses were observed in the region. Shortly thereafter, an increase in short-necked tortoises was observed in the region. What does this change in the species of tortoises suggest?

Answers

Answer:

A.  

Changes in the environment give rise to evolution of species.

Explanation:

I just did this on PLATO and I got 100%

Final answer:

The change in the species of tortoises suggests natural selection, where tortoises with shorter necks became more abundant in a region with grasses after a drought.

Explanation:

This change in the species of tortoises suggests natural selection at play. In the given scenario, tortoises with long necks were more abundant in regions with higher-level vegetation. This is because their longer necks allowed them to reach and access more leaves for food. However, when a drought hit the region and the vegetation dried up, grasses started to grow. As a result, short-necked tortoises had an advantage as they could easily access the grasses. Over time, these short-necked tortoises became more prevalent in the region.

According to thelen (1986), which reflex may contribute to the birthing process? the stepping reflex the rooting reflex the grasping reflex. the startle reflex.

Answers

According to Thelen {1986}, THE STEPPING REFLEX may contribute to the birthing process.
Stepping reflex is one of the reflexes demonstrate by new born babies. When resistance is exerted on the feet of a new born baby, the baby will respond by placing one foot in front of the other, this is called stepping reflex and Thelen suggested that this reflex may help in the birthing process.

The correct reflex that may contribute to the birthing process according to Thelen (1986) is the stepping reflex.

Thelen (1986) discussed the role of neonatal reflexes in the context of development and their potential functions. Among these reflexes, the stepping reflex is particularly interesting because it can be observed when a newborn is held upright with their feet touching a solid surface; the baby will make stepping movements. This reflex is thought to be a vestige of our evolutionary past, where it might have helped the infant to crawl and find the nipple to suckle shortly after birth.

While the stepping reflex is not directly involved in the process of birth itself, it is a reflex that emerges immediately after birth and could theoretically aid the infant in moving towards the mother's breast for feeding, which is an important aspect of the postnatal period. The other reflexes mentioned serve different purposes:

- The rooting reflex helps the baby find the nipple when the cheek is stroked.

- The grasping reflex occurs when the palm is stroked, causing the baby to grasp firmly.

- The startle reflex, also known as the Moro reflex, is a response to loud noises or the sensation of falling, where the baby throws out their arms and then pulls them back in.

As food molecules are broken down during __________, carbon is released back into the atmosphere as carbon dioxide.
a. breathing
b. the nitrogen cycle
c. the water cycle
d. cellular respiration

Answers

D. Cellular Respiration

Compare and contrast the structure of a mitochondrion with that of a prokaryotic cell.

Answers

Mitochondria resembles the prokaryotic cells in structure and function. It is believed that mitochondria has been originated from the prokaryotic cells, upon their fusion with the eukaryotic cells.

What is Mitochondria?

Mitochondria is known as the Power house of the cell as it makes energy in the form of ATP by the process of cellular respiration. This energy is utilized by the body tissues in various processes.

Mitochondria is a semi-autonomous and double-membranous organelle. It has its own genetic material. This genetic material is similar to the genetic material present in the prokaryotic cells. The genetic material is present in the form of small circular DNA in both the prokaryotic cell and mitochondria.

Mitochondria are formed by the process of binary fission which is similar to the prokaryotic cells.

Learn more about Mitochondria here:

https://brainly.com/question/14740753

#SPJ2

The restriction enzyme saci has a recognition sequence of gagct^c, where the caret (^) indicates the cut site. examine the dna molecule below. agagctcagtcgagagctcagatcgataggagctcagatctcgatcacctc tctcgagtcagctctcgagtctagctatcctcgagtctagagctagtggag how many separate molecules of dna would you end up with if you treated the above dna molecule with saci?

Answers

dge78wdgqwe8fguefuqefioequf9be

There are total three molecules of dna would you end up with if you treated the above dna molecule with saci.

What are restriction enzymes?

A restriction enzyme, restriction endonuclease, or restrictase is an enzyme that cleaves DNA into fragments at or near specific recognition sites within molecules known as restriction sites. Restriction enzymes are one class of the broader endonuclease group of enzymes.

Moreover, a restriction enzyme is a protein isolated from bacteria that cleaves DNA sequences at sequence-specific sites, producing DNA fragments with a known sequence at each end. The use of restriction enzymes is critical to certain laboratory methods, including recombinant DNA technology and genetic engineering.

Therefore, four types of restriction enzymes are recognized, designated I, II, III, and IV, which differ primarily in structure, cleavage site, specificity, and cofactors.

Learn more about restriction enzymes:

https://brainly.com/question/14953274

#SPJ6

Which statement best describes the population at point D? A.The carrying capacity has been reached. B.The population density is very low. C.The birthrate is very low. D.There is unlimited food and space.

Answers

I think it might be either A or B. Hope this helped. Have a great day! :D
A. The carrying capacity has been reached. 

As you can see from the graph that there is a red dotted line (Carry capacity) and at D. this has been met.

Approximately what percentage of roadside litter flies out of the back of pick-up trucks

Answers

Approximately 51% of roadside litter flies out of the back of pick up trucks.
According to the Texas department of Transportation, more than half of road side litters in Texas fly out of back of pick up trucks. The habit of putting litters at the back of the truck is considered to the same as throwing the litters out of the window and efforts are been made by the government to stop this type of littering.

Final answer:

The exact percentage of roadside litter that comes from pickup trucks is unspecified, but such littering contributes significantly to environmental pollution. Improper waste disposal, such as unsecured truck loads, exacerbates the issue of waste management and urban littering.

Explanation:

The percentage of roadside litter that flies out of the back of pickup trucks is not explicitly provided in the provided reference material. However, it is important to note that littering and improper disposal of waste contribute significantly to environmental pollution. Roadside litter, including plastic bags and fast food wrappers, often originates from various sources, and unsecured loads from vehicles are indeed a contributing factor.

According to a study from the Environmental Protection Agency (EPA), over 40 million tons of food waste were generated in 2017, indicating the scope of waste management issues. Also, much of the plastic waste that ends up in the ocean comes from riverine systems, with a significant percentage coming from just a few rivers mainly in Asia and Africa. Urban areas play a key role in plastic pollution due to the concentration of human activities and improper waste disposal practices, such as the littering of plastic bags referred to as 'roadside daisies' in South Africa.

While the question about pickup trucks is specific, the overall context of the environmental impact of polluting behaviors, such as littering and unsecured cargos, ties back to the broader themes of waste management, environmental conservation, and personal responsibility.

A female client presents to the health care provider's office with increasing stomach acidity. she self-administers calcium antacids. she notes that she seems to be having more issues with stomach acid, so she has been taking the calcium antacids more frequently. the nurse suspects that this may have caused what to occur in this client?

Answers

The nurse suspected that the client who seems to be having an issue with stomach acid, may have cause to what occur to the client is rebound acidity. Rebound acidity is an increase in gastric acid secretion basal or stimulated above pre-treatment levels following discontinuation of anti-secretory therapy.

The nurse is used to working on the postpartum floor taking care of women who have had normal vaginal births. today, however, the nurse has been assigned to help care for women who are less than 24 hours post cesarean birth. the nurse realizes that some areas will not be assessed. what would the nurse leave out of the client assessments

Answers

The answer is perineum, usually a woman who experiences cesarean birth does not have an episiotomy though seldom this may be the case. In addition, perineum is the area among the anus and the scrotum in the male and among the anus and the vulva the labial opening to the vagina in the female. An episiotomy is a surgical process to expand the outlet of the birth canal to ease delivery of the baby and evade a sharp rip of the perineum.
Other Questions
Andrew believes that the probability that he will win the tennis match is 2/9. what is the probability that he will lose the tennis match? Suppose you went for a swim, in a natural body of water, while staying in Istanbul, Turkey. In what major body of water are you probably swimming? Match the Progressive Era amendment with the type of issue it addressed.1.Sixteenthpolitical2.Seventeenthmoral3.Eighteenthsocial4.Nineteentheconomic How did geography of greece affect greek history? who was homer, and why was his work used as the basis for greek education? What is a major difference between goebbels 1943 speech and hirohitos speech which correct answer is it? A candle is 6 inches tall and burns at a rate of one half an inch per hour. Write an equation to represent the situation. Predict how an unusually prolonged drought might affect a biological community The benefit of fusion is that it:requires no fuelproduces more energyyields very little nuclear wasteis easier to control If triangle JKL s congruent to triangle RST which congruences are true by CPCTC Geneva rode her bike a total of 2 1/2 miles from her house to school. First she rode 4/5 mile from her house to the park. Then she rode 1/5 mile from the park to her friends house . Finally she rode the rest of the way to her school? How many miles did she ride from her friends house to school A dog that gets rewarded for the first bark it makes in each ten minute period is being reinforced on which schedule of reinforcement? Cuatro millones de personas utilizan el metro del D.F. todos los das. Qu pasara si el metro dejara de funcionar de repente? Compare aerobic respiration and fermentation in terms of efficiency of obtaining energy from glucose An urn contains two red and four white balls. balls are drawn from the urn successively, at random and with replacement. what is the probability that exactly three whites occur in the first five trials? BRAINLIEST FOR THE RIGHT ANSWER!!!Jim Smith is a salesman who receives a $1,100 draw per week. He receives a 12% commission on all sales. Sales for Jim were $205,000 for the month. Assuming a four-week month, Jim's commission after the draw is The __________ was the phase of the revolution in which huge numbers of french people were executed ASAP HELP FOR NUMBER 21!! DO 21 B, C, AND D!! PLS!(CORRECT ANSWERS PLS)(Random ANSWERS get moderated) Match each function with its possible output.1. NOW2. RAND3. SQRT4. TODAYA. 5B. 2/6/2015 16:10C. 02/06/15D. 0.27 The arch of septimius severus commemorated ___________. it consists of how many arches? according to one story, a youth named curtius saved rome near the lacus curtius by ___________. the curia was the building in which ___________ held their meetings. the rostra was used as a ___________. it was called rostra because _______________. the temple of castor and pollux served as a temple as well as what other purposes? what's all that's now left of this building? the regia was used for a couple different purposes. name them both. the temple of julius caesar was built on the site of ____________. what did the vestal virgins guard in the templum vestae? describe the shape of this building. the atrium of vesta was the home of the vestal virgins. at what age might a girl become a vestal virgin? the tabularium was used to _________________. as happened with quite a few temples, the temple of antoninus and faustina was later turned into what sort of building? find the milliarium aureum. what was inscribed on this column? what was the function of the basilica in ancient rome? the tullianum was part of the roman "carcer". what was the carcer's use? what was the original name of the roman colosseum. what items were stored in the temple of saturn? what was the name of the road (via) that ran through the forum? _____________________ Steam Workshop Downloader