Y-intercept is 100 and slope is 5. Partner gave example: Younger brother had 100 small building blocks, but lost 5 of them every month since. What mistake did Partner make?

Answers

Answer 1
since he lost 5 every month, it should be that the slope is -5, not 5, he is not gaining 5 every month


yint is 100 and slope is -5 would be correct
b=-5m+100
b=number of blocks he has after m months

Related Questions

how to calculate z=1.15 and z = 2.37 bell shaped normal distribution

Answers

P(1.15 < z < 2.37) = P(z < 2.37) - P(z < 1.15) = .9911 - .8749 = .1162

Look up 2.37 and 1.15 in table (attached)

2.37 ----> 0.9911
1.15 ----> 0.8749


what's the answer to this

Answers

it is y^12, hope this helps you
y¹¹.y = y¹²
Whenever, you need to multiply that type of digits then consider y as y¹ & then add the powers.
Here, powers are 11+1 = 12.
Write it on the top. You'll get your answer.

So, your final answer is y¹²

Hope this helps! Happy studying :)

A rectangular vegetable garden will have a width that is 2 feet less than the length, and an area of 48 square feet. If x represents the length, then the length can be found by solving the equation: x(x−2)=48 x(x-2)=48 What is the length, x, of the garden? The length is _____ feet.

Answers

The length is 8 feet 

Answer:

The length is [tex]8[/tex] feet.

Step-by-step explanation:

we know that

the area of the rectangle is equal to

[tex]A=xy[/tex]

where

x is the length side of rectangle

y is the width side of rectangle

In this problem we have

[tex]A=48\ ft^{2}[/tex]

so

[tex]48=xy[/tex] ----> equation A

[tex]y=x-2[/tex] ------> equation B

substitute equation B in equation A

[tex]48=x(x-2)[/tex]

[tex]x^{2}-2x-48=0[/tex]

The formula to solve a quadratic equation of the form [tex]ax^{2} +bx+c=0[/tex] is equal to

[tex]x=\frac{-b(+/-)\sqrt{b^{2}-4ac}} {2a}[/tex]

in this problem we have

[tex]x^{2}-2x-48=0[/tex]

so

[tex]a=1\\b=-2\\c=-48[/tex]

substitute in the formula

[tex]x=\frac{-(-2)(+/-)\sqrt{-2^{2}-4(1)(-48)}} {2(1)}[/tex]

[tex]x=\frac{2(+/-)\sqrt{4+192}} {2}[/tex]

[tex]x=\frac{2(+/-)14} {2}[/tex]

[tex]x=\frac{2+14} {2}=8\ ft[/tex]  -----> the solution

[tex]x=\frac{2-14} {2}=-6[/tex]

here is another question 2/5 divided by 1/6

Answers

2/5 divided by 1/6 = 12/5

12/5 = 2 2/5


if the area of the triangle is 84 inches squared what is the value of x

Answers

I hope this helps you

[tex]84[/tex]

[tex] \sqrt{84} [/tex]

Claire picked some apples. She used 2/5 of the apples to make jam, She gave 1/3 of the remainder to her neighbor. What fraction of the apples did she give to her neighbor? Can someone please explain step by step please

Answers

Of course! Let's start!


Lets imagine that you have a circle. That circle represents all of the apples that Claire has.

Now let's imagine this. You take 2/5 of that circle out, you completely wipe it away. These 2/5 are the apples she took out to make the jam.

Ok, so now you are left with 3/5 of the circle, or the apples.

You need to take out 1/3 of those apples to give to your neighbor. So we need to find 1/3 of 3/5.

So, draw 3 small circles on a piece of paper.

Those each represent 1 part of the 3/5.

So what is 1/3 of the three fifths?

1/5 because one circle is 1/3 of 3/5!

So the neighbor recieved 1/5 of the apples!

I hope this helped!

Comment if you have any questions!!
Glad to help!
Step 1:
Find remainder after making jam.
[tex]1 - \frac{2}{5} = \frac{5}{5} - \frac{2}{5} = \frac{3}{5} [/tex]

Step 2:
Find 1/3 of remainder.
The word "of" refers to multiplication.
[tex]\frac{1}{3} * \frac{3}{5} = \frac{3}{15} = \frac{1}{5} [/tex]

Therefore she gave 1/5 of apples to her neighbor.

Xy=30
3x-y=-9

Solve by the substitution method

Answers

If XY = 30, then we can make x=30/y.First:3x=-9+yx=-3+y/3By substitution, we get:30/y=3+y/330=3y+3y/y30=3y+33y=27y=9Hope this helps!

What is greater 7/12 0.75 or 5/6

Answers

7/12=.58
5/6= .83
soooo
if the numbers are .58, .83 and .75 your order would be 
.58, .75, .83
in other words
7/12, .75, 5/6
if your just looking for the biggest number your answer would be
5/6
hope this helps!

A theater can seat 144 people. The number of rows is 7 less than the number of seats in each row. How many rows of seats are there?

Answers

Final answer:

To determine the number of rows in the theater, we use the given information to create the equation x * (x - 7) = 144 where x is the number of seats per row. Factoring out, we find 16 and 9 as a suitable pair, leading to the conclusion that there are 9 rows of seats in the theater.

Explanation:

The student's question involves finding the number of rows of seats in a theater given certain constraints. To solve this problem, let's designate x as the number of seats in each row. According to the question, the number of rows of seats is 7 less than the number of seats in a row, which can be written as x - 7. Since we know the theater can seat 144 people in total, we can create the following equation to represent the total number of seats:

x  imes (x - 7) = 144

Solving this quadratic equation by factoring will give us the value of x, which will then allow us to calculate x - 7 for the number of rows. By factoring 144, we find that 16 and 9 are factors that satisfy the equation (16  imes 9 = 144) and also meet the condition that one factor is 7 less than the other (16 - 7 = 9). Therefore, the number of seats in each row is 16, and the number of rows is 16 - 7 which gives us 9 rows in the theater.

At his grandfather's funeral, rick cries, "grandpa's not coming back." approximately how old is rick?

Answers

It seems that you have missed the given options for this question, but anyway here is the answer. When Rick cries and said "grandpa's not coming back," during his grandfather's funeral, we can assume that Rick is approximately 3-5 years old. During this age, children begin to grasp death's finality and understands irreversibility. Hope this answer helps.
Final answer:

Rick's age cannot be determined based on his statement at his grandfather's funeral.

Explanation:

Rick's age cannot be determined based solely on his statement at his grandfather's funeral. Crying and expressing grief at a funeral is a normal response regardless of age. It is important to remember that people of all ages experience loss and express their emotions in different ways. Age is a complex and multifaceted characteristic influenced by a variety of factors. Therefore, it is not possible to accurately determine Rick's age based on the given information.

2500 kilobytes in 5 minutes

Answers

You just divide 5 by 2,500 and the answer you get is 500
divide 5 by 2,500 and the answer you get is 500

Is one period a complete cycle of a graph?

Answers

yes "period" and "cycle" are two terms that mean the same thing

the product of two consecutive even positive integers is 782 more than the sum of the two integers. Find the integers

Answers

28 and 30!

28*30 = 840

840 - 782 = 58

28 + 30 = 58
Final answer:

To find the consecutive even positive integers, we set up an equation based on the given information and solve for the variables.

Explanation:

Let's assume the first even positive integer is x. Therefore, the next consecutive even positive integer will be x + 2. According to the problem, the product of these two integers is 782 more than their sum. We can set up the equation as x(x + 2) = x + x + 2 + 782.

Simplifying the equation, we get x^2 + 2x = 2x + 784.

By solving this quadratic equation, we find that the value of x is 26. Therefore, the consecutive even positive integers are 26 and 28.

Learn more about Consecutive even positive integers here:

https://brainly.com/question/8395585

#SPJ2

at the bake sale connie bought 4 chocolate cookies kevin bought 4 brownies and luis bought 6 sugar cookies in simplest form what fraction represents the number of cookies bought

Answers

14 over 14 equals one

A wheel of radius 1.9 feet is moving forward at 12 feet per second. How fast is the wheel turning?

Answers

find the circumference to see how much of the wheel is touhing the ground

c=2pir
c=2pi1.9
c=2.8pi

2.8pi=distance per 1 rotation
number of rotations per second times 2.8pi=12feet per second
dvide both sides by 2.8pi
number of rorations per second=12/2.8pi
number of roations per second=6/1.4pi
number of roations per second=3/0.7pi
number of roations per second=30/7pi
aprox
number of roations per second=1.364 rotations per second

write the equation of a line perpendicular to 9x+8y=3 that passes through the point (8,-7). Type an equation using slope- intercept form or using the given point in point- slope form. use integers or simplified fractions for any numbers in the equation.

Answers

9x + 8y = 3
8y = -9x + 3
y = -9/8x + 3/8...slope here is -9/8. A perpendicular line will have a negative reciprocal slope. All that means is " flip " the slope and change the sign. So the perpendicular slope is 8/9 (see how I flipped the slope and changed the sign)

y = mx + b
slope(m) = 8/9
(8,-7)....x = 8 and y = -7
now we sub and find b, the y int
-7 = 8/9(8) + b
-7 = 64/9 + b
-7 - 64/9 = b
-63/9 - 64/9 = b
-127/9 = b

so ur equation is : y = 8/9x - 127/9

A rectangle has a length of 32 yards less than 3 times its width. If the area of the rectangle is 748 square yards, find the length of the rectangle.

Answers

I hope this helps you

The length of the rectangle will be 34 yards.

What is the area of the rectangle?

The space occupied by any two-dimensional figure in a plane is called the area. The two-dimensional space occupied by the rectangle is called the area of the rectangle.

Given that A rectangle has a length of 32 yards less than 3 times its width. If the area of the rectangle is 748 square yards. The length and the width will be calculated by forming an expression.

Area = L x W

Area = W ( 3W - 32 )

748 = 3W² - 32W

3W² -32W -748 = 0

W = 22 and W = -11

The width will be 22 yards put W in the expression of L to get L.

L= ( 3W - 32 )

L = ( 3 x 22 - 32 ) = 34 yards

Therefore, the length of the rectangle will be 34 yards.

To know more about the area of the rectangle follow

https://brainly.com/question/25292087

#SPJ2

A car rental cost $80 per day, for the first 250 miles, plus $0.20 for each additional mile. If Sonya's rental cost was $124 for one-day rental, how many miles did she drive?

Answers

i hope this helps you
Well, 80 dollars is the price originally, so that 80 is by its self. Now we see that its 0.2 ever mile after so lets do the math.

The equation would be $80 + $0.2x = 124

Do the math, subtract 80 from both sides

0.2x = 44

No divide by 0.2

x= 220

since the first $80 is 250 miles what would the rest be? well since you did the math and got x = 220 that means after you have 220 addition miles. Add the two up :) 220+250= 470 :D 

What is the compound interest if $410 is invested for 13 years at 8% compounded continuously?

Answers

compounded contiously
[tex]A=Pe^{rt} [/tex]
A=future amount
P=present amount
r=rate in decimal
t=time in years

to find the interest, we do A-P
find A first

given
P=410
t=13
r=0.08

[tex]A=410e^{13*0.08} [/tex]
[tex]A=410e^{1.04} [/tex]
aprox
A=1159.97897
A-P=1159.97897-410=749.9789
the interest is $749.98

A rectangle's length and width are in a ratio of 8:3. The area is 384 square millimeters. What are the length and width?

Please I really am desperate 

Answers

Let, the length = 8x
width = 3x
Now, 8x * 3x = 384
24x² = 384
x² = 384/24
x² = 16
x = √16
x = 4

So, length = 8(4) = 32 & Width = 3(4) = 12

It's dimension would be 32 × 12 mm

Hope this helps!

A recipe for a vegetable dish contains a total of 924 calories. The dish serves 6 people. How many calories are in each serving?

Answers

Each serving is just per person. So divided # of calories in total by 6

"x" = 924 / 6
"x" = 154
Divide the number of calories by 6 to get the amount for each serving.

From a standard desk of 52 card, 5 card are draw.What are the odds of each even occurring?
a) 5 aces
b) 5 face cards

Answers

I think it would be B. Hope this helps!
Event a cannot occur because card deck has only 4 aces. Which means the possibility they will be 5 aces is zero.

3. Jones of New York sold a fax machine for $400 to Ron Stationery of Boston. Terms of the sale on July 29 are 2/10 EOM FOB New York. Jones agreed to prepay the freight of $25. Assume Ron pays on September 4. How much will it pay Jones?

Answers

$400. Because Jones prepaid the freight and did not pay within the 10 day terms for the 2% discount. Hope this helps :F

slope=-1 and y-intercept (0,10).
graph the line.

Answers

I dont know how to upload a picture of a graph so I'll just try to explain it. Place a dot on (0, 10) then go to the right one unit and down 1 unit and mark another dot. Continue to do this until you have placed enough dots to make a line.

The interest on 6000 at 6% compounded semiannually for eight years is?

Answers

using the formula
I = P x R x T
        100
where
I is interest
P is principal
R is rate
T is time in years
I = 6000 x 6 x 8
            100
I = 2880
when compounded semi anually the interest will be multiplied by 2
2880 x 2
5760 is the answer

A recent survey suggests that 85% of adults know what Twitter is. How many adults should you survey in order to be 90% confident that your estimate is within 5% of the true population proportion?

Answers

an odd number of adults so you have no tie at all, I would recommend to survey at least 75 adults to get a good 90% confident.

find the radian measure of an angle at the center of a circle with radius 67.0 cm that intercepts an arc length of 118 cm

Answers

Arc length = radius* angle
Solving for angle
---> angle = ArcLength/radius

[tex] \theta = \frac{118}{67} [/tex]

This problem involves empirical probability. The table shows the breakdown of 97 thousand single parents on active duty in the U.S. military in a certain year. All numbers are in thousands and rounded to the nearest thousand. Use the data in the table to find the probability that a randomly selected single parent in the U.S. military is in the Army.

Answers

The table shows the breakdown of 97 thousand single parents on active duty in the ... of 97 thousand single parents on active duty in the U.S. military in a certain year. All numbers are in thousands and rounded to the nearest thousand. Use the data in the table to find the probability that a randomly selected single parent in ...

The probability that a randomly selected single parent in the U.S. military is a woman in the Air Force is [tex]\( \frac{6}{97} \)[/tex], which is approximately 0.0619 or 6.19%.

To find the probability that a randomly selected single parent in the U.S. military is a woman in the Air Force, we need to divide the number of women in the Air Force by the total number of single parents in the military.

1. First, find the number of women in the Air Force from the table. This is given as 6 thousand.

2. Next, find the total number of single parents in the military. This is given as 97 thousand.

3. Finally, divide the number of women in the Air Force by the total number of single parents in the military and express the result as a fraction or decimal to represent the probability.

So, the probability P can be calculated as:

[tex]\[ P = \frac{{\text{Number of women in the Air Force}}}{{\text{Total number of single parents}}} \][/tex]

Substituting the values:

[tex]\[ P = \frac{6}{97} \][/tex]

[tex]\[ P ≈ 0.0619 \][/tex]

Therefore, the probability that a randomly selected single parent in the U.S. military is a woman in the Air Force is approximately 0.0619 or 6.19%.

Complete question:

This problem involves empirical probability. The table shows the breakdown of 97 thousand single parents on active duty in the U.S. military in a certain year. All numbers are in thousands and rounded to the nearest thousand. Use the data in the table to find the probability that a randomly selected single parent in the U.S. military is a woman in the Air Force.

             Army    Navy   Marine Corps  Air Force  Total

Male        27         26            4                      14           71

Female    11            8             1                       6            26

Total        38          34           5                      20          97

The probability that a randomly selected single parent in the U.S. military is a woman in the Air Force is?

frieda has 12 red apples and 15 green apples she is going to share equally among8 people and keep any extra apples for herself.how many apples will frieda keep for herself

Answers

12+ 15= 27
27/8 = 3 with a remainder of 3.
she keeps 3 apples for herself.

Frieda will keep 3 apples to herself after sharing

Proportions

From the given question, we are told that frieda has 12 red apples and 15 green apples. The total number of fruit is expressed as:

Total = 12 + 15Total = 27 fruit

If she is going to share equally among 8 people, then the remainder when 27 is divided by 8 will be the remaining fruit

Taking the ratio

Ratio = 27/8

Ratio = 3 remainder 3

Frieda will keep 3 apples to herself after sharing

Learn more on proportion here: https://brainly.com/question/24481042

One student is selected at random from group of 12 freshmen, 16 sophomores, 20 juniors, and 2 seniors. Find the probability that the person selected is

Answers

12 / 50 = 0.24; 24% Chance the student is a Freshmen
16 / 50 = 0.32; 32% Chance the student is a Sophomore
20 / 50 = 0.40; 40% Chance the student is a Junior
2 / 50 = 0.04; 4% Chance the student is a Senior
easy  kinda
Other Questions
Why is radium valuable what is 3400 as a decimal answer asap Solve the given differential equation dN/dt=kN, (k=constant) ...? The trash, located by the sink, is always taken out at least once a week to keep the kitchen from smelling. What is the dangling modifier in this sentence? Given the ip address 192.168.112.0. each network requires between 35 and 60 hosts. what is the broadcast address of the first available subnet? 30 POINTS DONT ANSWER IF YOU DONT KNOW THE ANSWER FOR SUREIn the gene TATTCATTGTTATGATTTATTCG, CATTGTTA encodes for pepsin, a digestive enzyme. The rest of the sequence doesnt code for any protein. Which sequence contains a mutation that will affect the formation of pepsin?A. TATTCATTCATTATGATTTATTCGB. TATTCATTGTTATGACTTTATTCGC. TATTCATTGTTATGATTTATTGGCGD. TATTCATTGTTATGATATTCGE. TGCATTCATTGTTATGATTTATTCG A box is given a push so that it slides across the floor. How far will it go, given that the coefficient of kinetic friction is 0.15 and the push imparts an initial speed of 3.5m/s? When was the u.s. constitution written? what is bulimia? can someone explain it to me. Which items describe people's interactions with their environment?Technology does not affect the earth's environment.People adapt to their environment.People adapt their environment.Population growth and the environment are unrelated.Changes to the earth's environment rarely matter.Changes to the earth's environment can be harmful.Changes to the earth's environment can be beneficial. Choose the sentence that has the correct form of the verb ser. Ellas es muy inteligentes. Clara no es cubana. Nosotros son amigos. Yo eres serio. A rate that describes how much smaller or larger the scale drawing is than the real object Write 6% as a decimal. There are two main functions for polysaccharides in living things. Discuss these two functions, and how the structures of polysaccharide molecules support these functions.Now I know that all polysaccharides are made up of the same monomer, glucose. Is this question essentially asking me the use of glucose throughout different organisms? Which of the following represents the graph of f(x) = 2x + 2? algebra help?write a function rule for the area of a triangle with a base of 3 cm greater than 5 times its height. what is the area of a triangle when its height is 6 cm? 6 letter word: a stack of thylakoids in a chloroplast Explain how the powers of the Supreme Court and federal law were extended by significant court cases during the period Algae uses all the energy in sunlight to perform photosynthesis.true or false what is 2 1/2 divided by 1/3 Steam Workshop Downloader